View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17672_high_8 (Length: 374)
Name: NF17672_high_8
Description: NF17672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17672_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 20 - 360
Target Start/End: Original strand, 32695821 - 32696161
Alignment:
| Q |
20 |
atgatgatgacaagtaccctgatttgactcacacactttttgattctgaaggattggattttgctgggtcagtgattgataaggtgaagaattgtaagga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32695821 |
atgatgatgacaagtaccctgatttgactcacacactttttgattctgaaggattggattttgctgggtcagtgattgataaggtgaagaattgtaagga |
32695920 |
T |
|
| Q |
120 |
agaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattagaaggtttaaaaggaatataatcttgcagaaacaagat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32695921 |
agaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattaggaggtttaaaaggaatataatcttgcaaaaacaagat |
32696020 |
T |
|
| Q |
220 |
tcattgaagaggaagagggaaatggtgcagaagggtacttgaatttcaagtttgatcttgattcaatggctctatattgctgcacaggatccaaactcgt |
319 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32696021 |
tcattgaagaggaagagggaaatggtccaaaagggtgcttgaatttcaagtttgatcttgattcaatggctctatattgctgcacaggatccaaactcgt |
32696120 |
T |
|
| Q |
320 |
cctgatacacgaaagctcaacctcatcattctctccctttg |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32696121 |
cctgatacacgaaagctcaacctcatcattctctccctttg |
32696161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 32679731 - 32679976
Alignment:
| Q |
20 |
atgatgatgacaagtaccctgatttgactcacacactttttgattctgaaggattggattttgctgggtcagtgattgataaggtgaagaattgtaagga |
119 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||||||| ||||||||||||||||| ||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
32679731 |
atgatgatggcaagtaccctgacttgactcacactctttttgattttgaaggattggattttgatggctcagtgattgataaggtgaagatttgcaagga |
32679830 |
T |
|
| Q |
120 |
agaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattagaaggtttaaaaggaatataatcttgcagaaacaagat |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
32679831 |
agaagcagggaaagagtttaaacttgaggatgatattgatgaagttgccgatctttttattaggaggtttaaaagaaatataattttgcaaaaacaagat |
32679930 |
T |
|
| Q |
220 |
tcattgaagaggaagagggaaatggtgcagaagggtacttgaattt |
265 |
Q |
| |
|
||||||| ||||| |||||||| ||||| |||||||||| ||||| |
|
|
| T |
32679931 |
tcattgaggaggaggagggaaaccgtgcaaaagggtacttaaattt |
32679976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 57 - 265
Target Start/End: Original strand, 32686758 - 32686966
Alignment:
| Q |
57 |
ttttgattctgaaggattggattttgctgggtcagtgattgataaggtgaagaattgtaaggaagaagcagggaaagaatttaaacttgaggatgatatt |
156 |
Q |
| |
|
||||| |||| | ||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686758 |
ttttggttctcagggattggattttgacggatcggtgattgataaggtgaagaattgtaaggaagaagcagggaaagaatttaaacttgaggatgatatt |
32686857 |
T |
|
| Q |
157 |
gatgaagttgctgatctttttattagaaggtttaaaaggaatataatcttgcagaaacaagattcattgaagaggaagagggaaatggtgcagaagggta |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32686858 |
gatgaagttgctgatctttttattaggaggtttaaaaggaatataatcttgcaaaaacaagattcattgaagaggaagagggaaatggtccaaaagggtg |
32686957 |
T |
|
| Q |
257 |
cttgaattt |
265 |
Q |
| |
|
||||||||| |
|
|
| T |
32686958 |
cttgaattt |
32686966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University