View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17673_high_11 (Length: 294)
Name: NF17673_high_11
Description: NF17673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17673_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 24567131 - 24567327
Alignment:
| Q |
1 |
tatgggtagctttaagagtcaataaaagttcagctctaaatttaatgctgctctagtctaaagtttcatggctatcagcagttacctatgcacattattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24567131 |
tatgggtagctttaagagtcaataaaagttcagctctaaatttaatgctgctctagtctaaagtttcatggctatcagcacttacctatgcacattattt |
24567230 |
T |
 |
| Q |
101 |
gtgaagaaaagtttatataaaagttggcacaatctttctggtgatcctttaacttggtctaaaataaattatatatgtacacgattgattcttcatg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24567231 |
gtgaagaaaagtttatataaaagttggcacaatctttctggtgatcctttaacttggtctaaaataaattatatatgtacacgattgattcttcatg |
24567327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 239 - 275
Target Start/End: Original strand, 24567369 - 24567405
Alignment:
| Q |
239 |
aatgcaaacatctagattctatctttactggtatagt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24567369 |
aatgcaaacatctagattctatctttactggtatagt |
24567405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University