View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17673_high_4 (Length: 409)
Name: NF17673_high_4
Description: NF17673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17673_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 408
Target Start/End: Complemental strand, 47902642 - 47902250
Alignment:
| Q |
18 |
ctttttgccttaatcgacattattgcatacttatatgctccaattatgaacttacagccacacacggtccctttgccaaccaaaattattcacactagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47902642 |
ctttttgccttaatcgacattattgcatacttatatgctccaattatgaatttacagccacacgcggtccctttgccaaccaaaattattcacactagag |
47902543 |
T |
 |
| Q |
118 |
aataccaatcacccaactcaaccacaattgcacgtgttatacatagcaccttgttactcattaaaaaatttataagnnnnnnncataactcaattggcag |
217 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
47902542 |
aataccagtcactcaactcaaccacaattgcacgtgttatacatagcaccttgttactcattaaaaaatttataagttttgttcataactcaattgatag |
47902443 |
T |
 |
| Q |
218 |
agaggttgcattttatatgttggggttagagtttgaacaaattctctactaattcatctgaatggtgaatttacggtttatttga-caaaaaggtaaaaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47902442 |
agaggttgcattttatatgttggggttagagtttgaacaaattctctacttattcatctgaatggtgaatttacggtttatttgataaaaaaggtaaaaa |
47902343 |
T |
 |
| Q |
317 |
attatgaactaatttgcatcgtatagtccttctacttta-nnnnnnnngaggtatagtccttctacttatgtgcttcttaaggcagcagcgtt |
408 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47902342 |
attatgaactaatttgcatcctatagtccttctactttatttttttttgaggtatagtccttctacttatgtgcttcttaaggcagcagcgtt |
47902250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University