View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17673_low_20 (Length: 240)
Name: NF17673_low_20
Description: NF17673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17673_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 6287225 - 6286999
Alignment:
| Q |
1 |
ctattccctcaactcctacctatggttgttttattgttaatgttttacttaaaatcaataagaactattgtgtctttttgtaccttatttcaggaaccag |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6287225 |
ctattccctcacctcctacctatggttgttttattgttaatgttttacttaaaatcaataagaactattgtgtctttttgtaccttatttcagaaaccag |
6287126 |
T |
 |
| Q |
101 |
tttgtctcatatatatggttcaaatatggtatcagtttagtttttcctacctcccatggcttccatgaatggtaacaatcctttcacacccgttgagtgg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6287125 |
tt-gtctcatatatatggttcaaatatggtatcagtttagtttttcctacctcacatggcttccatgaatggtaacaatcctttcacacccgttgagtgg |
6287027 |
T |
 |
| Q |
201 |
tgacagtgactctttctgacaagaataa |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
6287026 |
tgacagtgacactttctgacaagaataa |
6286999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 6350725 - 6350660
Alignment:
| Q |
21 |
tatggttgttttattgttaatgttttacttaaaatcaataagaactattgtgtctttttgtacctt |
86 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||||||| |||||||||| |||||||||| |
|
|
| T |
6350725 |
tatgtttgttttattgttaatgttttactttacatcaataagaattattgtgtctgtttgtacctt |
6350660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 6350482 - 6350442
Alignment:
| Q |
148 |
tacctcccatggcttccatgaatggtaacaatcctttcaca |
188 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
6350482 |
tacctcccatgacttccatgattggtaacaattctttcaca |
6350442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University