View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17674_high_4 (Length: 318)
Name: NF17674_high_4
Description: NF17674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17674_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 48492023 - 48491859
Alignment:
| Q |
16 |
atgaaatttggggggttcccgctctaacgggtacaactatgagtcnnnnnnncatgaatgacgaaactgcacgatatttatatccttttcgacacgtcac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48492023 |
atgaaatttggggggttcccgctctaacgggtacaactatgagtcaaaaa--cttgaatgacgaaactgcacgatatttatatccttttcgacacgtcac |
48491926 |
T |
 |
| Q |
116 |
catctttatcggttacttcaccttttcggtttctctttacgccttcaccttcgcttcaccgtatcca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48491925 |
catctttatcggttacttcaccttttcgatttctctttacgccttcaccttcgcttcaccgtatcca |
48491859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University