View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17674_low_2 (Length: 404)
Name: NF17674_low_2
Description: NF17674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17674_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 25 - 382
Target Start/End: Complemental strand, 45101138 - 45100782
Alignment:
| Q |
25 |
gaacaattacaaaactagcaataaggaagttaagcgtgactcgactgccaactcaacaactatgtgtgtaaagttgaatgtattacccccacaagcgaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45101138 |
gaacaattacaaaactagcaataaggaagttaagcgtgactcgactgccaactcaacaactatgtgtgtaaagttgaatgtattacccccacaagcgaaa |
45101039 |
T |
|
| Q |
125 |
gaaatatatctagcaatccaaacttggcactacaagaattatagaccacctagaaaaccgttcttcgcagattttagactatcaattattacaagcggtc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||| | ||||||||||||||| |
|
|
| T |
45101038 |
gaaatatatctagcaatccaaacttggcactacaagaattatagaccacctagaaaagcattcttggcagattttagactataagttattacaagcggtc |
45100939 |
T |
|
| Q |
225 |
taaaccctcagtaagtaaggaaaacccttcaaaaattnnnnnnnnnnnntggcaaaatgatgacattactaacggtctaaaccctcactaattttagaag |
324 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||| |||| ||||||| |||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
45100938 |
taaaccctcagtaaaaaagaaaaacccttcaaaaatt-aaaaaaaagaatggcgaaatgatcacataactaactgtctaaaccctcactaattttagaag |
45100840 |
T |
|
| Q |
325 |
cgaaggcaattttaatttactagcggtctaagccgccattatgaagaagacaaatttg |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45100839 |
cgaaggcaattttaatttactagcggtctaagccgccattatgaagaagacaaatttg |
45100782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University