View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17675_high_11 (Length: 249)
Name: NF17675_high_11
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17675_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 243
Target Start/End: Original strand, 43060066 - 43060292
Alignment:
| Q |
21 |
ttttattgcagaggtgtttttgttgagcaggctggaagtaatgtggcattatttttgcatcttttacaagttttaggatttttgtttaatttgttgcaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43060066 |
ttttattgcagaggtgtttttgttgagcaggctggaagtaatgtggcattatttttgcatcttttacaagttttaggatttttgtttaatttgttgcaaa |
43060165 |
T |
 |
| Q |
121 |
tgcatccttattgtgaagtgtgctctttttgtttat----gatatttcttctgctgacaatgtgattaatttattggcgtttggcaagctcaaattcatg |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43060166 |
tgcatccttattgtgcagtgtgctctttttgtttatataagatatttcttctgctgacaatgtgattaatttattggcgtttggcaagctcaaattaatt |
43060265 |
T |
 |
| Q |
217 |
tgtgatgtatctatctaattgtttatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43060266 |
tgtgatgtatctatctaattgtttatt |
43060292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University