View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17675_low_10 (Length: 278)
Name: NF17675_low_10
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17675_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 98 - 263
Target Start/End: Original strand, 38868434 - 38868599
Alignment:
| Q |
98 |
gagggaaggattccttgttttagcagccaatcatcagtttgttacacaaatatgaaatatttatataaaggagtttgctaattagaccaatctaaaaaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38868434 |
gagggaaggattccttgttttagcagccaatcatcagtttgttgcacaaatatgaaatatttatacaaaggagtttgctaattagaccaatctaaaaaca |
38868533 |
T |
|
| Q |
198 |
tgaagtctaagtaggcaagtgtgtacctttttatttgttatgaatgtctcaaatactttaactcac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868534 |
tgaagtctaagtaggcaagtgtgtacctttttatttgttatgaatgtctcaaatactttaactcac |
38868599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 89
Target Start/End: Complemental strand, 38868385 - 38868347
Alignment:
| Q |
51 |
aaacacaccagaaacaaaacacgaaaactgttgaccaaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38868385 |
aaacacaccagaaacaaaacacgaaaactgtcgaccaaa |
38868347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University