View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17675_low_13 (Length: 247)
Name: NF17675_low_13
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17675_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 24 - 236
Target Start/End: Original strand, 13974675 - 13974887
Alignment:
| Q |
24 |
gatgcttgtccattgggggtccagttatctcttgatacaaaaggataccagtctggactaaaggatgataaacattctgatatggtaaatttgcacagct |
123 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974675 |
gatgcttgtccattgggtgtccagttatctcttgatacaacaggataccagtctggactaaaggatgataaacattctgatatggtaaatttgcacagct |
13974774 |
T |
 |
| Q |
124 |
ctcctgatacgcgnnnnnnngttatgtataaatatatttcctgtattttaacctgtacagtcacgtacatgaaattatgcaggttgatgttccattattt |
223 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974775 |
ctcctcatacgcgtttttttgttaagtataaatatatttcctgtattttaacctgtacagtcacgtacatgaaattatgcaggttgatgttccattattt |
13974874 |
T |
 |
| Q |
224 |
actattgatgatg |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13974875 |
actattgatgatg |
13974887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University