View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17675_low_6 (Length: 401)
Name: NF17675_low_6
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17675_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 9e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 10981361 - 10981253
Alignment:
| Q |
1 |
agccaccatgaatgagcataaaccaactgatgtaagcaataactgatggttccatagcacatcagaattgcaactactaatttgaattctttgtttgact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10981361 |
agccaccatgaatgagcataaaccaactgatgtaaaccttaactgatggttccatagcacatcagaattgcaactactaatttgaattctttgtttgatt |
10981262 |
T |
|
| Q |
101 |
gttttcttt |
109 |
Q |
| |
|
|| |||||| |
|
|
| T |
10981261 |
gtattcttt |
10981253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 3e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 42933440 - 42933517
Alignment:
| Q |
18 |
ataaaccaactgatgtaagcaataactgatggttccatagcacatcagaattgcaactactaatttgaattctttgtt |
95 |
Q |
| |
|
||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
42933440 |
ataaacccactgatgtaagcattaaccgatggttccatagcacatcagaattgcaactgctaattagaattctttgtt |
42933517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 25 - 92
Target Start/End: Original strand, 41427247 - 41427314
Alignment:
| Q |
25 |
aactgatgtaagcaataactgatggttccatagcacatcagaattgcaactactaatttgaattcttt |
92 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
41427247 |
aactgatgtaagcattgactgatggttccatagcacatcagaattgcaactgctaattagaattcttt |
41427314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University