View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17675_low_7 (Length: 321)
Name: NF17675_low_7
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17675_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 27386418 - 27386629
Alignment:
| Q |
15 |
aaatgtttttccatacttcaccgcatatgcgaaggaacccaagtgcatatgtgaaaattaaagaactaaaatgatcccattatgacataactacctcatg |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27386418 |
aaatgtttttccatacttcactgcatatgcgaaggaacccaagtgcatatgtgaaaattaaagaactaaaatgatcccattatgacataactacctcatg |
27386517 |
T |
|
| Q |
115 |
tataataggaagtccatacctgcaatttcctcccttatgcttgcttgctcgcacatgtgttttctac---attgaacgccaaaattggtttttctattac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27386518 |
tataataggaagtccatacctgcaatttcctcccttatgcttgcttgctcgcacatgtgttttctacattattgaacgccaaaattggtttttctattac |
27386617 |
T |
|
| Q |
212 |
tcgagttcctgc |
223 |
Q |
| |
|
| |||||||||| |
|
|
| T |
27386618 |
ttgagttcctgc |
27386629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 295
Target Start/End: Original strand, 27386630 - 27386668
Alignment:
| Q |
257 |
ataacctaagtcttgtaacaaatacatcctcacacattc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27386630 |
ataacctaagtcttgtaacaaatacatcttcacacattc |
27386668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University