View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17675_low_9 (Length: 293)
Name: NF17675_low_9
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17675_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 85 - 194
Target Start/End: Original strand, 8326403 - 8326511
Alignment:
| Q |
85 |
ttggatgtaaaaattaattcttattcaaaacaatcaaatcgtgtcaaagttaattatatatctagaaacaattttgactaatcaacaagtagaatctctt |
184 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8326403 |
ttggatgtaaaa-ttaattcttattcaaaacaatcaaatcgtgtcaaagttaattatatatctagaatcaattttgactaatcaacaagtagaatctctt |
8326501 |
T |
|
| Q |
185 |
tctttagaaa |
194 |
Q |
| |
|
|||||||||| |
|
|
| T |
8326502 |
tctttagaaa |
8326511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University