View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17675_low_9 (Length: 293)

Name: NF17675_low_9
Description: NF17675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17675_low_9
NF17675_low_9
[»] chr1 (1 HSPs)
chr1 (85-194)||(8326403-8326511)


Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 85 - 194
Target Start/End: Original strand, 8326403 - 8326511
Alignment:
85 ttggatgtaaaaattaattcttattcaaaacaatcaaatcgtgtcaaagttaattatatatctagaaacaattttgactaatcaacaagtagaatctctt 184  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
8326403 ttggatgtaaaa-ttaattcttattcaaaacaatcaaatcgtgtcaaagttaattatatatctagaatcaattttgactaatcaacaagtagaatctctt 8326501  T
185 tctttagaaa 194  Q
    ||||||||||    
8326502 tctttagaaa 8326511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University