View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17676_high_22 (Length: 325)
Name: NF17676_high_22
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17676_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 87 - 282
Target Start/End: Original strand, 19823783 - 19823973
Alignment:
| Q |
87 |
tttgtcgtcgtgttcaatttctctccttttctgaacttgtattaataatatacaagatcaaccaaaaatatctcttgtccttgctcttagaagataccat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19823783 |
tttgtcgtcgtgttcaatttctctccttttctgaacttctattaataatatacaagatcaatcaaaaatatctcttgtccttgctctgagaagatac--- |
19823879 |
T |
 |
| Q |
187 |
accagtgaacaagaggttaggttttggtcatgtgaccttttccaaaagttattcctatgctcgctcaatgccaaaccattcaagtataaagcatgt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19823880 |
--cagtgaacaagaggttaggttttggtcatgtgaccttttccaaaagttattcctatgctcgctcaatgccaaaccattcaagtataaagcatgt |
19823973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 19822584 - 19822648
Alignment:
| Q |
1 |
cccctctcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaagtttaagg |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822584 |
cccctctcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaagtttaagg |
19822648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 91
Target Start/End: Complemental strand, 23189935 - 23189902
Alignment:
| Q |
58 |
gtttaaggtttagggtttagggtttagggtttgt |
91 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23189935 |
gtttagggtttagggtttagggtttagggtttgt |
23189902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 91
Target Start/End: Complemental strand, 23611190 - 23611157
Alignment:
| Q |
58 |
gtttaaggtttagggtttagggtttagggtttgt |
91 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23611190 |
gtttagggtttagggtttagggtttagggtttgt |
23611157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 89
Target Start/End: Complemental strand, 138 - 102
Alignment:
| Q |
53 |
tttaagtttaaggtttagggtttagggtttagggttt |
89 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
138 |
tttaggtttagggtttagggtttagggtttagggttt |
102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University