View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17676_low_13 (Length: 397)
Name: NF17676_low_13
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17676_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 52993227 - 52993048
Alignment:
| Q |
19 |
actattgctttcatttctcaaatttgtgtaccctcccttcaaatatgttgctcttgctgctgttgttgccggcatttatccaatcttcttgaaagctatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993227 |
actattgctttcatttctcaaatttgtgtacactcccttcaaatatgttgctcttgctgctgttgttgccggcatttatccaatcttcttgaaagctatt |
52993128 |
T |
 |
| Q |
119 |
gtttccattcggaatcttagaattgacattaacattcttgtcatcatagcaggtataatttcatttgcttaatactataa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993127 |
gtttccattcggaatcttagaattgacattaacattcttgtcatcatagcaggtataatttcatttgcttaatactataa |
52993048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 241 - 365
Target Start/End: Complemental strand, 52993010 - 52992886
Alignment:
| Q |
241 |
gttcccaaacatgtgaaagggtattatttcatactacttaagttggtttactagttgaccaattttcaaattgttaattttattgagattcaaataaaaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993010 |
gttcccaaacatgtgaaagggtattatttcatactacttaagttggtttactagttgaccaattttcaaattgttaattttattgagattcaaataaaag |
52992911 |
T |
 |
| Q |
341 |
ccgttgcttttgctcataaaactcg |
365 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
52992910 |
ccgttgcgtttgctcataaaactcg |
52992886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University