View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17676_low_15 (Length: 391)
Name: NF17676_low_15
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17676_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 63 - 373
Target Start/End: Original strand, 4195125 - 4195435
Alignment:
| Q |
63 |
tacacaatggtaacacaaactgaaccgttgctaaaaccaacctacatttcattgcaagaacttcaaaaacacaacactcgcggcgatgcatggatctcca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195125 |
tacacaatggtaacacaaactgaaccgttgctaaaaccaacctacatttcattgcaagaacttcaaaaacacaacactcgcggcgatgcatggatctcca |
4195224 |
T |
 |
| Q |
163 |
ttgacggcaagatctacgacgtttcaaaatgggccaaccaccatcccggcggcgagcttcctctcctcaacctcgccggccaagatgtcaccgatgcatt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195225 |
ttgacggcaagatctacgacgtttcaaaatgggccaaccaccatcccggcggcgagcttcctctcctcaacctcgccggccaagatgtcaccgatgcatt |
4195324 |
T |
 |
| Q |
263 |
cctcgctttccaccctccatccgcttacaaacacctccaaaactttgccactggcagttacctacgtgactacgtcgtctctgacgtctcacgtgactat |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195325 |
cctcgctttccaccctccatccgcttacaaacacctccaaaactttgccactggcagttacctacgtgactacgtcgtctctgacgtctcacgtgactat |
4195424 |
T |
 |
| Q |
363 |
cgtgccctttt |
373 |
Q |
| |
|
||||||||||| |
|
|
| T |
4195425 |
cgtgccctttt |
4195435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 160 - 280
Target Start/End: Original strand, 4186190 - 4186310
Alignment:
| Q |
160 |
ccattgacggcaagatctacgacgtttcaaaatgggccaaccaccatcccggcggcgagcttcctctcctcaacctcgccggccaagatgtcaccgatgc |
259 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||||||||| ||||| | ||||| ||| ||| ||||||||||| || || || || |
|
|
| T |
4186190 |
ccattgacggcaagatatacgacgtctctaaatgggccaaccaccatcccggtggcgaattccctctaatcagccttgccggccaagaggttactgaagc |
4186289 |
T |
 |
| Q |
260 |
attcctcgctttccaccctcc |
280 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
4186290 |
attccttgctttccaccctcc |
4186310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 95 - 138
Target Start/End: Original strand, 4186137 - 4186180
Alignment:
| Q |
95 |
aaaaccaacctacatttcattgcaagaacttcaaaaacacaaca |
138 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4186137 |
aaaaccaacctacatttcactgcaagaactccaaaaacacaaca |
4186180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University