View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17676_low_23 (Length: 318)
Name: NF17676_low_23
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17676_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 112 - 302
Target Start/End: Complemental strand, 43037657 - 43037466
Alignment:
| Q |
112 |
attcaacaacctccgcccccgctttccaccttgactatgccgctctccatcgtctctccggcaaactcctcac-ctctccatctttgtttacaacggccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43037657 |
attcaacaacctccgcccccgctttccaccttgactatgctgctctccatcgtctctccggcaaactcctcactctctccatctttgtttacaacggccc |
43037558 |
T |
 |
| Q |
211 |
aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaata |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43037557 |
aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaata |
43037466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University