View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17676_low_27 (Length: 277)
Name: NF17676_low_27
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17676_low_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 19822343 - 19822602
Alignment:
| Q |
18 |
taaaatatgcttttgattaatttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagaggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822343 |
taaaatatgcttttgattaatttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagaggat |
19822442 |
T |
 |
| Q |
118 |
aaagatctcatattttcttccataatgacataattattgtcattagagtaaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822443 |
aaagatctcatattttcttccataatgacataattattgtcattagagtaaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgtg |
19822542 |
T |
 |
| Q |
218 |
caacaatgatggtaaagttaagccttttgttgattgtaaatcccctctcttctttcttca |
277 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19822543 |
caacaatgatggtaaagttaagacttttgttgatggtaaatcccctctcttctttcttca |
19822602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 138
Target Start/End: Original strand, 30864154 - 30864255
Alignment:
| Q |
37 |
atttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagagga-taaagatctcatattttct |
135 |
Q |
| |
|
|||||||| |||||| |||||||||| || ||||||||||| ||| ||||||||||||| ||||| |||| ||||||| | |||||||||||||| || |
|
|
| T |
30864154 |
atttttgt-tgattttggttaattttgatcaacaatgttgttttaagcgtcctcttttgattttttgctgtttcagaggagtgaagatctcatatttact |
30864252 |
T |
 |
| Q |
136 |
tcc |
138 |
Q |
| |
|
||| |
|
|
| T |
30864253 |
tcc |
30864255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University