View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17676_low_28 (Length: 273)
Name: NF17676_low_28
Description: NF17676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17676_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 126 - 230
Target Start/End: Original strand, 29556764 - 29556868
Alignment:
| Q |
126 |
cataagaatccagatttgaagtgtaattgttgcttatatcaaataataaaatttatgtagctattctttatggacttatacagcaaggatgaatcctaag |
225 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29556764 |
cataagaatccagatttggagtgtaattgttgcttatatcaaataataaaatttatgtagctattctttatggacttatacagcaaggatgaatcctaag |
29556863 |
T |
 |
| Q |
226 |
gatag |
230 |
Q |
| |
|
||||| |
|
|
| T |
29556864 |
gatag |
29556868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 29556653 - 29556708
Alignment:
| Q |
18 |
cattggagtttttcacccaatttgagtgtgattgctccttattatctcaaataata |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29556653 |
cattggagtttttcacccaatttgagtgtgattgctccttattatctcaaataata |
29556708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University