View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17677_high_7 (Length: 345)
Name: NF17677_high_7
Description: NF17677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17677_high_7 |
 |  |
|
| [»] chr4 (9 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 11 - 345
Target Start/End: Original strand, 2383036 - 2383374
Alignment:
| Q |
11 |
cacagaggagaagaataacttagatggtaatgatactgcatagtgatagaggtagctaacgggacatttgatgggatgaagaaaattactgaagtctttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2383036 |
cacagaggagaagaataacttagatggtaatgatactgcata-tgatagaggtagctaacgggacatttgatgggatgaagaaaattactgaagtctttc |
2383134 |
T |
 |
| Q |
111 |
agttttggagtatattttttatttacaaaatttgatggttcacttctttatacatgttaagcacttggcatattgcattattattgacattaagaatgag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2383135 |
agttttggagtatattttttatttacaaaatttgatggttcacttctttatacatgttaagcacttggcatattgcattattattgacattaagaatgag |
2383234 |
T |
 |
| Q |
211 |
aatttgggtctcaaccttacttttccggtttcacttctgaacataggcatatttatccaaggttgttaaaacc-----ggaccggccggttcaaccggtt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2383235 |
aatttgggtctcaaccttacttttccggtttcacttctgaacataggcatatttatccaaggttgttaaaaccggactggaccggccggttcaaccggtt |
2383334 |
T |
 |
| Q |
306 |
gaacagtgaaccggaccacagaccggtccgattgagcctc |
345 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2383335 |
gaaccgtgaaccggaccacagaccggtccgattgagcctc |
2383374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 67 - 244
Target Start/End: Original strand, 2382025 - 2382205
Alignment:
| Q |
67 |
taacgggacatttgatgggatgaagaaaattactgaagtctttcagttttggagtatattttt---tatttacaaaatttgatggttcacttctttatac |
163 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||| | ||| || |||||| ||||||||| |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
2382025 |
taacggaacatttgatgggatgatgaaaattactgaaatattttagctttggaatatatttttgtctatttacaaaatttgatgattcacttgtttatac |
2382124 |
T |
 |
| Q |
164 |
atgttaagcacttggcatattgcattattattgacattaagaatgagaatttgggtctcaaccttacttttccggtttcac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
2382125 |
atgttaagcacttggcatattgcattattattgacattaaggatgagaatttgggtctcaaccctacttttggggtttcac |
2382205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 114 - 234
Target Start/End: Original strand, 2391798 - 2391919
Alignment:
| Q |
114 |
tttggagtatattttt----tatttacaaaatttgatggttcacttctttatacatgttaagcacttggcatattgcattattattgacattaagaatga |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2391798 |
tttggagtatatttttgtcttatttacaaaatttg---gttcacttgtttatacatgtttagcacttggcatattgcattattattgaatttaagaatga |
2391894 |
T |
 |
| Q |
210 |
gaatttgggtctcaaccttactttt |
234 |
Q |
| |
|
|||||| |||||||||| ||||||| |
|
|
| T |
2391895 |
gaatttcggtctcaaccatactttt |
2391919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 167 - 265
Target Start/End: Complemental strand, 2546242 - 2546146
Alignment:
| Q |
167 |
ttaagcacttggcatattgcattattattgacattaagaatgagaatttgggtctcaaccttacttttccggtttcacttctgaacataggcatattta |
265 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| ||||| | |||||||| ||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2546242 |
ttaagcacttggcatattgtattctttttgacat-aagaaagggaatttggttctcaactttacttttg-ggtttcatttctgaacataggcatattta |
2546146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 2380684 - 2380728
Alignment:
| Q |
15 |
gaggagaagaataacttagatggtaatgatactgcatagtgatag |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2380684 |
gaggagaagaataacttagatggtaatgatactgcatagtcatag |
2380728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 56
Target Start/End: Original strand, 2381894 - 2381939
Alignment:
| Q |
11 |
cacagaggagaagaataacttagatggtaatgatactgcatagtga |
56 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2381894 |
cacagagtagaagaataacttagatggtaatgatgctgcatagtga |
2381939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 44352865 - 44352809
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggaccacagaccggtccgat |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
44352865 |
accggaccggccggttcgaccggttgaaccgtgaaccggacccctaaccggtccgat |
44352809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 319
Target Start/End: Original strand, 33727999 - 33728038
Alignment:
| Q |
280 |
aaccggaccggccggttcaaccggttgaacagtgaaccgg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33727999 |
aaccggaccggccggttcaaccggttgaaccgtgaaccgg |
33728038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 55164612 - 55164572
Alignment:
| Q |
283 |
cggaccggccggttcaaccggttgaacagtgaaccggacca |
323 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
55164612 |
cggaccggccggttcaattggttggacagtgaaccggacca |
55164572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 6752724 - 6752779
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggaccacagaccggtccga |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| ||| ||||||||||| |
|
|
| T |
6752724 |
accggaccggccggttcaaccggttgaaccgggaaccggaacactgaccggtccga |
6752779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 39843980 - 39843925
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggaccacagaccggtccga |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||| | |||||||| ||| ||||||||||| |
|
|
| T |
39843980 |
accggaccggccggttcaatcggttgaaccgggaaccggaacactgaccggtccga |
39843925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 281 - 322
Target Start/End: Complemental strand, 50211754 - 50211713
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggacc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
50211754 |
accggaccggccggttcaaccggttgaaccgggaaccggacc |
50211713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 23091340 - 23091395
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggaccacagaccggtccga |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||| | |||| ||| ||| ||||||||||| |
|
|
| T |
23091340 |
accggaccggccggttcaatcggttgaaccgggaactggaacactgaccggtccga |
23091395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 336
Target Start/End: Original strand, 34151101 - 34151159
Alignment:
| Q |
278 |
aaaaccggaccggccggttcaaccggttgaacagtgaaccggaccacagaccggtccga |
336 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| | |||||| | ||| ||||||||||| |
|
|
| T |
34151101 |
aaaaccgggccgaccggttcaaccggttgaaccgggaaccgaaacactgaccggtccga |
34151159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 336
Target Start/End: Complemental strand, 34176023 - 34175965
Alignment:
| Q |
278 |
aaaaccggaccggccggttcaaccggttgaacagtgaaccggaccacagaccggtccga |
336 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| | |||||| | ||| ||||||||||| |
|
|
| T |
34176023 |
aaaaccgggccgaccggttcaaccggttgaaccgggaaccgaaacactgaccggtccga |
34175965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 45268699 - 45268737
Alignment:
| Q |
283 |
cggaccggccggttcaaccggttgaacagtgaaccggac |
321 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
45268699 |
cggaccggccggttcaaccggttgaaccgggaaccggac |
45268737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 322
Target Start/End: Original strand, 174247 - 174288
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggacc |
322 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||||||||| |
|
|
| T |
174247 |
accggaccggccggttcaaccggttggaccgggaaccggacc |
174288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 322
Target Start/End: Complemental strand, 13833398 - 13833357
Alignment:
| Q |
281 |
accggaccggccggttcaaccggttgaacagtgaaccggacc |
322 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
13833398 |
accggaccggccggttcaaccgattgaaccgagaaccggacc |
13833357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University