View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17677_high_9 (Length: 338)
Name: NF17677_high_9
Description: NF17677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17677_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 27080903 - 27080984
Alignment:
| Q |
19 |
gtctcatggtccatcaaactcctctaataagtctctttaacctcctctactcggattctatacctatttcgatataatatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27080903 |
gtctcatggtccatcaaactcctctaataagtctctttaacctcctctactcggattctatacctatttcgatataatatag |
27080984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 27148754 - 27148673
Alignment:
| Q |
19 |
gtctcatggtccatcaaactcctctaataagtctctttaacctcctctactcggattctatacctatttcgatataatatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27148754 |
gtctcatggtccatcaaactcctctaataagtctctttaacctcctctactcggattctatacctatttcgatataatatag |
27148673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 330
Target Start/End: Original strand, 27081100 - 27081137
Alignment:
| Q |
293 |
gcaattattcgatccttataaacactacccttcttctc |
330 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
27081100 |
gcaattatttgatccttataaacacttcccttcttctc |
27081137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 330
Target Start/End: Complemental strand, 27148557 - 27148520
Alignment:
| Q |
293 |
gcaattattcgatccttataaacactacccttcttctc |
330 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
27148557 |
gcaattatttgatccttataaacacttcccttcttctc |
27148520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 232
Target Start/End: Original strand, 27080999 - 27081039
Alignment:
| Q |
192 |
atttatactttcctcttttacgttttgtcctttagctttgt |
232 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
27080999 |
atttttactttccttttttactttttgtcctttagctttgt |
27081039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 232
Target Start/End: Complemental strand, 27148658 - 27148618
Alignment:
| Q |
192 |
atttatactttcctcttttacgttttgtcctttagctttgt |
232 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
27148658 |
atttttactttccttttttactttttgtcctttagctttgt |
27148618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University