View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17677_low_12 (Length: 277)
Name: NF17677_low_12
Description: NF17677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17677_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 53267411 - 53267657
Alignment:
| Q |
14 |
gaaggtgaaatttctgggttgagtttatggataatatactcatattgatagtgcacacccctaaggctgagatattgtcctttgtactcgctcttaatgg |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267411 |
gaaggtgaagtttctgggttgagtttatggataatatactcatattgatacagcacacccctaaggctgagatattgtcctttgtactcgctcttaatgg |
53267510 |
T |
 |
| Q |
114 |
catccacgttttagttcaaccgtacctcctccattttaaaaacttcacatgcacaattttgtaatgttaaatcagttcttaagttcattcgaagtaaaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267511 |
catccacgttttagttcaaccgtacctcctccattttaaaaacttcacatgcacaattttgtaatgttaaatcagttcttaagttcattcgaagtaaaaa |
53267610 |
T |
 |
| Q |
214 |
tttattaaaagtaggtgtttttcaaacaagcgtgacaaaggtacatgt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53267611 |
tttattaaaagtaggtgtttttcaaacaagcgt-acaaaggtacatgt |
53267657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University