View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17678_low_13 (Length: 292)
Name: NF17678_low_13
Description: NF17678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17678_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 13 - 276
Target Start/End: Original strand, 10461693 - 10461956
Alignment:
| Q |
13 |
caaaggggaattgtcaaacaatgattaaataatatgaaaatgcagcatgataagcaaaccttattaccttaatgttataaaaaactttaccattggagat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461693 |
caaaggggaattgtcaaacaatgattaaataatatgaaaatgcagcatgataagcaaaccttattaccttaatgttataaaaaactttaccattggagat |
10461792 |
T |
 |
| Q |
113 |
aatcggaaagttgctgtagcttccgcgctgaaacctgttattccaccagcagggaacaagtatgtcaatagcgtcggggatgttgggtccaaacatatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461793 |
aatcggaaagttgctgtagcttccgcgctgaaacctgttattccaccagcagggaacaagtatgtcaatagcgtcggggatgttgggtccaaacatatcc |
10461892 |
T |
 |
| Q |
213 |
ctgagcaccgccatagcttctctcaaagtctcttcattggtctgagcttccacacgttttgatt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461893 |
ctgagcaccgccatagcttctctcaaagtctcttcattggtctgagcttccacacgttttgatt |
10461956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University