View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17679_low_5 (Length: 210)
Name: NF17679_low_5
Description: NF17679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17679_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 19775551 - 19775362
Alignment:
| Q |
1 |
tgcgatgagaaggtggtggtggtgtggcattgtggtaatttgggggtttaaggagtaagttaatggaggaaagatatgtggttgttgagggtgaaggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19775551 |
tgcgatgagaaggtggtggtggtgtggcattgtagtgatttgggggtttaaggagtaagttaatggaggaaagatatgtggttgttgaaggtgaaggttg |
19775452 |
T |
|
| Q |
101 |
ttgaagtaggaagggaattcttcttttcat---tactgtggtagtcacttcagggggtttattttcagagaagagaaacgttttccaact |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
19775451 |
ttgaagtaggaagggaattcttcttttcattactactgtagtagtcacttcagggggtttattttcagagaagagaaaggctttccaact |
19775362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University