View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1767_high_11 (Length: 305)
Name: NF1767_high_11
Description: NF1767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1767_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 9440890 - 9440603
Alignment:
| Q |
1 |
gtaatttcaatattgtggacttttagatcgtatggttcacttcatggagaaaaagaaaagtcttttaaatatctatatgcttttcattgtggattttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9440890 |
gtaatttcaatattgtggacttttagatcgtatggttcacttcatggagaaaaagaaaagtcttttaaatatctatatgattttcattgtggattttcaa |
9440791 |
T |
 |
| Q |
101 |
atcttatggttcaatgtggactattaaatcgtatggacgtgtcaataaactatcgtcccaattattatatccatacgtatttttataatctggttctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
9440790 |
atcttatggttcaatgtggactattaaatcgtatggacgtgtcaataaactatcgtcccaattat--tatccatacgtatttttataatctggttcttct |
9440693 |
T |
 |
| Q |
201 |
tataatgtctctccccaaaccatatgttaccctattgttatcaataactacaaaaatggtaacctttacaaatattttggtggtcatgat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9440692 |
tataatgtctctccccaaaccatatgttaccctattgttatcaataactacaaaaatggtaacctttacaaatattttggtggtcatgat |
9440603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University