View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1767_high_16 (Length: 250)
Name: NF1767_high_16
Description: NF1767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1767_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 33 - 241
Target Start/End: Complemental strand, 31999889 - 31999679
Alignment:
| Q |
33 |
aagacttagagacagattttagcttttaactct--aaatttccttcttcatttcaactttttctgtagtttatgcacttataaatgatcaattctatcat |
130 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31999889 |
aagacttcgagacagattttagcttttaactctctaaatttccttcttcattacaactttttctgtagtttatgcacttataaatgatcaattctatcat |
31999790 |
T |
 |
| Q |
131 |
attttagttctgcataacatgacgtggagacggtgctttcaatcttgtgtaatttgttgttctaattttctgcaaacttactgagttttattttccttat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31999789 |
attttagttctgcataacatgacgtggagacggtgctttcaatcttttgtaatttgttgttctaattttctgcaaacttactgagttttattttccttat |
31999690 |
T |
 |
| Q |
231 |
ttggtgatgat |
241 |
Q |
| |
|
||||||||||| |
|
|
| T |
31999689 |
ttggtgatgat |
31999679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 31999950 - 31999905
Alignment:
| Q |
1 |
gaaaataaaattgatcaccaaattggacgtct--aagacttagaga |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31999950 |
gaaaataaaattgatcaccaaattggacgtctccaagacttagaga |
31999905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University