View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1767_high_18 (Length: 226)
Name: NF1767_high_18
Description: NF1767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1767_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 67 - 205
Target Start/End: Complemental strand, 31960350 - 31960207
Alignment:
| Q |
67 |
tacaatggaatttgggaagtaagagaaatattatttttaataaaaaatttccatttcttgtttttgtta-----aagagtgctccaagaacatcgattaa |
161 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31960350 |
tacaatggaatttggaaagtaagagaaatattatttttaataaaaaatttccattttttgtttttgttaaagctaagagtgctccaagaacatcgattaa |
31960251 |
T |
 |
| Q |
162 |
tatgactcagaaaacaatagcacaaggtaagaaaagttaccgat |
205 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31960250 |
tatgacgcataaaacaatatcacaaggtaagaaaagttaccgat |
31960207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University