View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1767_low_13 (Length: 266)
Name: NF1767_low_13
Description: NF1767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1767_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 22 - 255
Target Start/End: Complemental strand, 33457879 - 33457646
Alignment:
| Q |
22 |
ccgaggagatgaataaaccagagagctccacattaaatttgacgtcacaatgatgaaggcgcggcaaggtagaatgctgcgacaagaatcagagaccaca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33457879 |
ccgaggagatgaataaaccagagagctccacagtaaatttgacgtcacaatgatgaaggcgcgacaaggtagaatgctgcgacaagaatcagagaccaca |
33457780 |
T |
 |
| Q |
122 |
atagtgcagaagatgcacaaaaacagatgtctctctaatattttcatcatgcgttgatctcatctgttcatccaacaaccaatgtcattgatcatacata |
221 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33457779 |
acagtgcagaagatgcacaaaaacagttgtctctctaatattttcatcatgcgttgatctcatctgttcatccaacaaccaatgtcattgatcatacata |
33457680 |
T |
 |
| Q |
222 |
aattttcccataaattataaatttcaagagtata |
255 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
33457679 |
aattttcccataaattatgaatttcaagagtata |
33457646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University