View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17680_low_10 (Length: 277)
Name: NF17680_low_10
Description: NF17680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17680_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 44237823 - 44237570
Alignment:
| Q |
18 |
gatattccaacaattgaagttcgatataacaatctgaaaattgatgctgaagcgtttgtgggaagtagagctttgcctagtttcatcaatgctgctacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44237823 |
gatattccaacaattgaagttcgatataacaatctgaaaattgatgctgaagcgtttgtgggaagtagagctttgcctagtttcatcaatgctgctacta |
44237724 |
T |
|
| Q |
118 |
atgttatagaggtaaggagtg--nnnnnnnnttatagtacttcataaaatgactgaagttttttctttcttcgatctgttttgcttttgcatttaagtct |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44237723 |
atgttatagaggtaaggagtgaaaaaaaaaattatagtacttcataaaatgactgaagttttttctttcttcgatctgttttgcttttgcatttaagtct |
44237624 |
T |
|
| Q |
216 |
cacaagtaaccaaaatatatctttctttgtttcagggtatattgaattttcttc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44237623 |
cacaagtaaccaaaatatatctttctttgtttcagggtgtattgaattttcttc |
44237570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 44227030 - 44226917
Alignment:
| Q |
18 |
gatattccaacaattgaagttcgatataacaatctgaaaattgatgctgaagcgtttgtgggaagtagagctttgcctagtttcatcaatgctgctacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44227030 |
gatattccaacaattgaagttcgataccagaacctgaaaattgatgctgaagcgtttgtgggaagtagagctttgcctagtttcattaatgctgctacta |
44226931 |
T |
|
| Q |
118 |
atgttatagaggta |
131 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
44226930 |
atgttgtagaggta |
44226917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 44214873 - 44214760
Alignment:
| Q |
18 |
gatattccaacaattgaagttcgatataacaatctgaaaattgatgctgaagcgtttgtgggaagtagagctttgcctagtttcatcaatgctgctacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| | || |||||||||||||| ||||| |||||||||||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
44214873 |
gatattccaacaattgaagttcgataccagaacctgaaaattgatgccgaagcttttgtgggaagtcgagctttgcctagtttcattaacgctgctacta |
44214774 |
T |
|
| Q |
118 |
atgttatagaggta |
131 |
Q |
| |
|
||||| | |||||| |
|
|
| T |
44214773 |
atgttgtcgaggta |
44214760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 269
Target Start/End: Complemental strand, 44214704 - 44214622
Alignment:
| Q |
189 |
atctgttttgcttttgcatttaagtctcacaagtaaccaaaatatat--ctttctttgtttcagggtatattgaattttcttc |
269 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||| ||||||||| |||| ||||||||||||| |||| |||||||||| |
|
|
| T |
44214704 |
atctgttttgtttttgcagttgagtctcacaagtaaaaaaaatatatatctttttttgtttcagggtgtattcaattttcttc |
44214622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University