View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17680_low_11 (Length: 275)
Name: NF17680_low_11
Description: NF17680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17680_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 259
Target Start/End: Original strand, 41218335 - 41218582
Alignment:
| Q |
15 |
cagagatattctcaggtggtggtttcactgcagtttcagctgaatcagaagttccagctgaagctctcaaaggagagagggagaataaaggaagattctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41218335 |
cagagatattctcaggtggtggtttcactgcagtttcagctgaatcagaagttccagctgaagctctcaaaggagagagggacaataaaggaagattctt |
41218434 |
T |
 |
| Q |
115 |
gggtctgagagtgagagtaaagagattgttgctgtggtttg---gatgatggggtttggagagtgaagaatgagtggttgagattctagtgagaggagaa |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41218435 |
tggtctgagagtgagagtaaagtgattgttgctgtggtttggatgatgatggggtttggagagtgaagaataagtggttgagattctagtgagaggagaa |
41218534 |
T |
 |
| Q |
212 |
aaagaagccatagacatagacatagttgttgacatggttttaaagttg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41218535 |
aaagaagccatagacatagacatagttgttgacatggttttaaagttg |
41218582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 41215567 - 41215615
Alignment:
| Q |
174 |
gtgaagaatgagtggttgagattctagtgagaggagaaaaagaagccat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41215567 |
gtgaagaatgagtggttgagattcaagtgagaggagagaaagaagccat |
41215615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University