View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17680_low_12 (Length: 252)
Name: NF17680_low_12
Description: NF17680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17680_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 16 - 136
Target Start/End: Complemental strand, 8003224 - 8003104
Alignment:
| Q |
16 |
atatcaaatcaatttaaaatcttcaaaatcacttttgaaaataggatattgagaggctattagtgatggctatgtgctgctttgacacccatgtgaagct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003224 |
atatcaaatcaatttaaaatcttcaaaatcatttttgaaaataggatattgagaggctattagtgatggctatgtgctgctttgacacccatgtgaagct |
8003125 |
T |
|
| Q |
116 |
gaattttcatgaacccccatc |
136 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8003124 |
gaattttcatgaacccccatc |
8003104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 183 - 252
Target Start/End: Complemental strand, 8003057 - 8002988
Alignment:
| Q |
183 |
tgatacttgagaaggttggattttgacatgacatattgatatgcacatataattgttgttaaaagcatgc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003057 |
tgatacttgagaaggttggattttgacatgacatgttgatatgcacatataattgttgttaaaagcatgc |
8002988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University