View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17680_low_14 (Length: 238)
Name: NF17680_low_14
Description: NF17680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17680_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 1206164 - 1206251
Alignment:
| Q |
1 |
gtgcatgaacccataacccctattttaatagcaactatcagttttacaagaaatatatttctatcataagttatcaaaatatgtgaag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1206164 |
gtgcatgaacccataacccctattttaatagcaactatcagttttacaagaaatatatttctatcataagttatcaaaatatgtgaag |
1206251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 1206313 - 1206386
Alignment:
| Q |
149 |
ccaccaaccagaatcatgatcttgttgttcatcatccgctggaattggcagtctgatgtgataacgcttcatgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1206313 |
ccaccaaccagaatcatgatcttgttgttcatcatccgctggaattggcagtctgatgtgataacgcttcatgt |
1206386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University