View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17680_low_17 (Length: 207)
Name: NF17680_low_17
Description: NF17680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17680_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 32014022 - 32014194
Alignment:
| Q |
17 |
tctcaataattatgagtgatattcgttgtccaaataattgggaggattagaagggattttgtctcctggaagagcaatatcaaaagtgtgtcgtgggtgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32014022 |
tctcaataattatgagtgatattcgttgtccaaataattgggaggattagaagggattgtgtctcctggaagagcaatataaaaagtgtgtcgtgggtgg |
32014121 |
T |
 |
| Q |
117 |
gtaatgttcaaacacaaccttacaacaattcagactttcatacaaaaaataaaatcctaacattcccacattc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32014122 |
gtaatgttcaaacacaaccttacaacaattcagactctcatacaaaaaataaaatcctaacattcccatattc |
32014194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University