View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_high_15 (Length: 314)
Name: NF17681_high_15
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 215 - 266
Target Start/End: Complemental strand, 25900419 - 25900368
Alignment:
| Q |
215 |
gagacctgttgtgccatttggtagtgcaagtagaaagcctcatgttgattct |
266 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25900419 |
gagacctgttgcgccatttggtagtgcaagtagaaagcctcatgttgattct |
25900368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 266
Target Start/End: Original strand, 40067818 - 40067869
Alignment:
| Q |
215 |
gagacctgttgtgccatttggtagtgcaagtagaaagcctcatgttgattct |
266 |
Q |
| |
|
||||||||| | ||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40067818 |
gagacctgtcgcgccttttggaagtgcaagtagaaagcctcatgttgattct |
40067869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 46
Target Start/End: Complemental strand, 6844043 - 6844011
Alignment:
| Q |
14 |
cagaacctgtgagttagttagaagctattcagc |
46 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
6844043 |
cagaacctgtgagtgagttagaagctattcagc |
6844011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University