View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_high_37 (Length: 214)
Name: NF17681_high_37
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 93 - 197
Target Start/End: Complemental strand, 41127002 - 41126898
Alignment:
| Q |
93 |
gtatgttgagataatggcgtctgtttcttatatcagagaggaccagacaaataaatttacattcatctctctctagaagggtataaacctgcaatatgtg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127002 |
gtatgttgagataatggcgtctgtttcttatatcagagaggaccagacaaataaatttacattcatctctctctagaagggtataaacctgcaatatgtg |
41126903 |
T |
 |
| Q |
193 |
tattt |
197 |
Q |
| |
|
||||| |
|
|
| T |
41126902 |
tattt |
41126898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University