View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17681_high_38 (Length: 207)

Name: NF17681_high_38
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17681_high_38
NF17681_high_38
[»] chr7 (2 HSPs)
chr7 (16-188)||(47803465-47803637)
chr7 (83-154)||(47806322-47806393)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 47803637 - 47803465
Alignment:
16 atgaacaaacacttattttgttttaaaaatagtctaacctttcaccatctagaatccaaaatattccgataaaattgcatatttacatgaacacggttat 115  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
47803637 atgaacaaacacttcttttgttttaaaaatagtctaacctttcaccatctagaatccaaaatattcagataaaattgcatatttacatgaacacggttat 47803538  T
116 gagatgaaattactgaaaagtacatgtttcaaaatcaatatgtaaatactagtgtcctatgtaggtagctcgg 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47803537 gagatgaaattactgaaaagtacatgtttcaaaatcaatatgtaaatactagtgtcctatgtaggtagctcgg 47803465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 83 - 154
Target Start/End: Complemental strand, 47806393 - 47806322
Alignment:
83 gataaaattgcatatttacatgaacacggttatgagatgaaattactgaaaagtacatgtttcaaaatcaat 154  Q
    ||||||||||||||| | ||||| || | || | |||| |||||||||||||||||||||||||||||||||    
47806393 gataaaattgcatatctgcatgagcatgattttaagataaaattactgaaaagtacatgtttcaaaatcaat 47806322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University