View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_high_7 (Length: 406)
Name: NF17681_high_7
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 15 - 394
Target Start/End: Complemental strand, 41037848 - 41037473
Alignment:
| Q |
15 |
gaaatgttatggatcaataaaaaatgttcccatcattgttccaactttttaaaatatttgactgggattttgctgacagcggtcacaaactgcaaaagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41037848 |
gaaatgttatggatcaataaaaaatgttcccatcattgttccaactttttaaaatatttgactgggattttgctgacagcggtcacaaactgcaaaagct |
41037749 |
T |
 |
| Q |
115 |
tttctataacaaagccaaaatagattatttaaatannnnnnnnnnnnnnnnnccttataagattgcaaatttaatcttgaccaaaaataaataaataatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||| || || |
|
|
| T |
41037748 |
tttctataacaaagccaaaatagattattcaaatatttttcttttcttttttccttataagattgcaaatttaatcttgaccaaaaaaaaaaaa----tt |
41037653 |
T |
 |
| Q |
215 |
gcaaatttaatgcttggcatgataattaatgagtggttttgttgcctccataagacaaagcccaccaaatgagctagctttattgttgctttctatcatc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41037652 |
gcaaatttaatgcttggcatgataattaatgagtggttttgttgcctccataagacaaagcccaccaaatgagctagctttattgttgctttctatcatc |
41037553 |
T |
 |
| Q |
315 |
tacctttttcctgcaagctgggatttcgtggatgaaaaaatgtctcttaatttctataatttcatggttcttgttcatct |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41037552 |
tacctttttcctgcaagctgggatttcgtggatgaaaaaatgtctcttaatttctataatttcatggttcttgttcatct |
41037473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University