View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_14 (Length: 320)
Name: NF17681_low_14
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_14 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 155 - 320
Target Start/End: Original strand, 35522875 - 35523040
Alignment:
| Q |
155 |
atcaggggcatggaaaatcactttggtatatgcaaggaatgtttagagcaaatggagggtgtggttatgtgaaaaagcctgtttttcttatggaaaaagg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35522875 |
atcaggggcatggaaaatcactttggtatatgcaaggaatgtttagagcaaatggagggtgtggttatgtgaaaaagcctgtttttcttatggagaaagg |
35522974 |
T |
|
| Q |
255 |
tccacacagtgagtgttttgatcctaaaagaacactgccagtgaagaagacattgaaggtgagata |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35522975 |
tccacacagtgagtgttttgatcctaaaagaacactgccagtgaagaagacattgaaggtgagata |
35523040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 7 - 94
Target Start/End: Original strand, 35522727 - 35522814
Alignment:
| Q |
7 |
ggagcacagatggtcgcatttaacatgcaggtcagggacttaagatcaagtctcttttcaaataaaaggtttatcttagtatttacta |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35522727 |
ggagctcagatggtcgcatttaacatgcaggtcagggacttaagatcaagtctcttttcaaataaaaggtttatcttagtatttacta |
35522814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 166 - 235
Target Start/End: Original strand, 35509551 - 35509620
Alignment:
| Q |
166 |
ggaaaatcactttggtatatgcaaggaatgtttagagcaaatggagggtgtggttatgtgaaaaagcctg |
235 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
35509551 |
ggaaaatcactctggttgatgcaaggaatgttcagagcaaatggaggatgtggttatgtaaaaaagcctg |
35509620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 35552852 - 35552911
Alignment:
| Q |
171 |
atcactttggtatatgcaaggaatgtttagagcaaatggagggtgtggttatgtgaaaaa |
230 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35552852 |
atcactttggttgatgcatggaatgtttagagccaatggagggtgtggttatgttaaaaa |
35552911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 157 - 235
Target Start/End: Original strand, 31653775 - 31653853
Alignment:
| Q |
157 |
caggggcatggaaaatcactttggtatatgcaaggaatgtttagagcaaatggagggtgtggttatgtgaaaaagcctg |
235 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||| ||||| | ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
31653775 |
caggggcatggcaaatcactccggttgatgcaagggatgttcaaagcgaatggagggtgtggttatgtgaaaaaacctg |
31653853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 157 - 235
Target Start/End: Original strand, 31703961 - 31704039
Alignment:
| Q |
157 |
caggggcatggaaaatcactttggtatatgcaaggaatgtttagagcaaatggagggtgtggttatgtgaaaaagcctg |
235 |
Q |
| |
|
||||||||||| ||| |||| ||| |||||||| ||||| | ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
31703961 |
caggggcatggcaaaccactccggttgatgcaagggatgttcaaagcgaatggagggtgtggttatgtgaaaaaacctg |
31704039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University