View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_21 (Length: 282)
Name: NF17681_low_21
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 21 - 271
Target Start/End: Complemental strand, 39114663 - 39114413
Alignment:
| Q |
21 |
attggtaaccagctaatcgttgagagcatgcatgtatatgtggaggaggttgctaaacacttcgaaaaatgggaccatatatttgctaccattaatccaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39114663 |
attggtaaccagctaatcgttgagagcatgcatgtatatgtggaggaggttgctaaacatttcgaaaaatgggaccatatatttgctaccattaatccaa |
39114564 |
T |
 |
| Q |
121 |
acataccatggcatggctatggctacttgtctagtccaatccaactgtacgtacgttctttgattttgagagccatctattctcatatctgtcttggaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39114563 |
acataccatggcatggctatggctacttgtctagtccaatccaactgtacgtacgttctttgattttgagagccatctattctcatatctgtcttggaaa |
39114464 |
T |
 |
| Q |
221 |
ctcttgacacagtcgcatatactatatacaatttgttcttgtctcattcat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39114463 |
ctcttgacacagtcgcatatactatatacaatttgttcttgtctcattcat |
39114413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University