View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_24 (Length: 255)
Name: NF17681_low_24
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 85 - 189
Target Start/End: Original strand, 4582228 - 4582332
Alignment:
| Q |
85 |
ttatacatgccatttaatcaaattacttggttgaatgtgatcagatgcatatttaaaaatgttttattctgttgatatatacaaattaactccatgtaca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4582228 |
ttatacatgccatttaatcaaattacttggttgaatgcgatcagatgcatgtttaaaaatgttttattctgctgatatatacaaattaactccatgtaca |
4582327 |
T |
 |
| Q |
185 |
tgtag |
189 |
Q |
| |
|
||||| |
|
|
| T |
4582328 |
tgtag |
4582332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University