View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_28 (Length: 242)
Name: NF17681_low_28
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 223
Target Start/End: Original strand, 45757197 - 45757414
Alignment:
| Q |
6 |
gaagaaaatagatagattacatttctcaattttcgaacttgaccacgaagaccggtaatttcatcatcgaaatcaccaacaggatcaatacgcaattgaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45757197 |
gaagaaaatagatagattacatttctcaattttcgaacttgaccacgaagaccggtaatttcatcatcgaaatcaccaacaggatcaatacgcaattgaa |
45757296 |
T |
 |
| Q |
106 |
tttcatcggaggatgcagcaggggttctggtgctaagtccctctctgcatttgaatgaatttaaacatttcaatatcaatttatttgaatcgaagaaatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45757297 |
tttcatcggaggatgcagcaggggttctggtgctaagtccctctctgcatttgaatgaatttaaacatttcaatatcaatttatttgaatcgaagaaatt |
45757396 |
T |
 |
| Q |
206 |
gaaagagaggaagggtgt |
223 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
45757397 |
gaaagagaggaaaggtgt |
45757414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University