View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_30 (Length: 241)
Name: NF17681_low_30
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 49110512 - 49110729
Alignment:
| Q |
11 |
cacagacagaagttctgctgcttggaacaaagggagaattcattacacaaatgctccgaaggaagttgtagatgcttatgcaaatcagtatcaaaaagac |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49110512 |
cacagacagaagttctgctgcttgtaacaaagggagaattcattacacaaatgctccgaaggaagttgtagatgcttatgcaaatcagtatcaaaaagac |
49110611 |
T |
|
| Q |
111 |
atggaaattttcttgcatgcaagagcacaagagcttgtgggaaatggactaatggcacttcaaattcctgctgcaactgatgttatttttgattctgatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49110612 |
atggaaattttcttgcatgcaagagcacaagagcttgtgggaaatggactaatggcacttcaaattcctgctgcaactgatgttacttttgattctgatt |
49110711 |
T |
|
| Q |
211 |
tttactgtggtaaaaact |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
49110712 |
tttactgtggtaaaaact |
49110729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University