View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_33 (Length: 235)
Name: NF17681_low_33
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 3488724 - 3488506
Alignment:
| Q |
3 |
cataaaaagaaactcaccttaaactaattcctcagcaagcccacatcnnnnnnnnnnnnnnnnn-ccatggaaactcatgtaaaacacgaaacaggttca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
3488724 |
cataaaaagaaactcaccttaaactaattcctcagcaagcccacatcaaaaaactacaaaaaaaaccatcgaaactcatgtaaaacacgaaacaggttca |
3488625 |
T |
 |
| Q |
102 |
agaaaaagggtatactttgaaacccttttttcaaaactcaaaacaaaatcacatatttcaaagaacccaataattttctcacaaatatcatagtttaaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3488624 |
agaaaaagggtatactttgaaacccttttttcaaaactcaaa-caaaatcacatatttcaaagaacccaataattttctcacaaatatcatagtttaaaa |
3488526 |
T |
 |
| Q |
202 |
agaacacgtacctttgttat |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3488525 |
agaacacgtacctttgttat |
3488506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University