View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_37 (Length: 228)
Name: NF17681_low_37
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 45 - 212
Target Start/End: Complemental strand, 1726110 - 1725943
Alignment:
| Q |
45 |
tctattaaactatacaagaaagatccaaaacaatacactaaaaagaagtggattacattgaatccacatggtggggcttgaattcaagatgtaaaaaata |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1726110 |
tctattaaactatacaagaaagatccaaaacaatacactaaaaagaagtggattacattgaatccacatggtggggcttgaattcaagatgtaaaaaata |
1726011 |
T |
 |
| Q |
145 |
tatagattttcattttggaagagagagaccaaactatgctatatactattgttttgacaattatagtt |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
1726010 |
tatagattttaattttggaagagagagaccaaactatgctatatattattgttttgacatttatagtt |
1725943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University