View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17681_low_41 (Length: 207)
Name: NF17681_low_41
Description: NF17681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17681_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 47803637 - 47803465
Alignment:
| Q |
16 |
atgaacaaacacttattttgttttaaaaatagtctaacctttcaccatctagaatccaaaatattccgataaaattgcatatttacatgaacacggttat |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47803637 |
atgaacaaacacttcttttgttttaaaaatagtctaacctttcaccatctagaatccaaaatattcagataaaattgcatatttacatgaacacggttat |
47803538 |
T |
 |
| Q |
116 |
gagatgaaattactgaaaagtacatgtttcaaaatcaatatgtaaatactagtgtcctatgtaggtagctcgg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803537 |
gagatgaaattactgaaaagtacatgtttcaaaatcaatatgtaaatactagtgtcctatgtaggtagctcgg |
47803465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 83 - 154
Target Start/End: Complemental strand, 47806393 - 47806322
Alignment:
| Q |
83 |
gataaaattgcatatttacatgaacacggttatgagatgaaattactgaaaagtacatgtttcaaaatcaat |
154 |
Q |
| |
|
||||||||||||||| | ||||| || | || | |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47806393 |
gataaaattgcatatctgcatgagcatgattttaagataaaattactgaaaagtacatgtttcaaaatcaat |
47806322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University