View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17682_high_16 (Length: 295)
Name: NF17682_high_16
Description: NF17682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17682_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 92 - 280
Target Start/End: Original strand, 31040022 - 31040210
Alignment:
| Q |
92 |
ataacaacaatatcaggtgatgatgccttgatactttttctttgttctcttactctcacaagtcgttcaactctggaaccactattataattaccattac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31040022 |
ataacaacaatatcaggtgatgatgccttgatactttttctttgttctcttactctcacaagtcgttcaactctggaaccactattataattaccattac |
31040121 |
T |
 |
| Q |
192 |
acttgtttccaggcatatgttcactctggaaccccaccattgaaattgaatatcaatttcagttacagcttaacttctttcccctgcat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31040122 |
acttgtttccaggcatatgttcactctggaaccccaccattgaaattgaatatcaatttcagttacagcttaacttctttcccctgcat |
31040210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University