View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17682_high_25 (Length: 213)
Name: NF17682_high_25
Description: NF17682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17682_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 2759151 - 2758974
Alignment:
| Q |
17 |
acttggaaatttgtcaattggtactccgtataatgaagaggttgcaaatgctgttaagatcattgaggaacacttgaaggatcatcgatcttggaggtcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2759151 |
acttggaaatttgtcaattggtactccgtataatgaagaggttgcaaatgctgttaagatcattgaggaacacttgaaggttcatcgatcttggaggtcc |
2759052 |
T |
 |
| Q |
117 |
gaaaataaaaacaatgcaacttgtgatgatggtaaaggaatatatgtgtatgatttaccatccaagtttaacaaggat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2759051 |
gaaaataaaaacaatgcaacttgtgatgatggtaaaggaatatatgtgtatgatttaccatccaagtttaacaaggat |
2758974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 49 - 194
Target Start/End: Complemental strand, 2755158 - 2755013
Alignment:
| Q |
49 |
atgaagaggttgcaaatgctgttaagatcattgaggaacacttgaaggatcatcgatcttggaggtccgaaaataaaaacaatgcaacttgtgatgatgg |
148 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| ||||||| ||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2755158 |
atgaagaggttgcatatgctgttaagatcatcgaggaacaattgaaggttcaacgatcgtggagatccgaaaataaaaacaatgcaacttgtgatgatgg |
2755059 |
T |
 |
| Q |
149 |
taaaggaatatatgtgtatgatttaccatccaagtttaacaaggat |
194 |
Q |
| |
|
| ||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
2755058 |
tcaaggaatttatgtgtatgatttaccatccagatttaacaaggat |
2755013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University