View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17682_low_12 (Length: 338)
Name: NF17682_low_12
Description: NF17682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17682_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 38753281 - 38752954
Alignment:
| Q |
1 |
gttgatgtggttgtggcacaggtacatgatgagactgttggaaattcaaggtgataggtcccttgtgtgttgcaaatgacatggcagattttatggtagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38753281 |
gttgatgtggttgtggcacaggtacatgatgaggttgttggaaattcaaggtgataggtcccttgtgtgttgcaaatgacatggcagattttatggtagg |
38753182 |
T |
|
| Q |
101 |
acaacctgtgaattgttgaaccaaagccctgaaatttgtgctattggcattgagaagagtaattggagttttctttgaagctctagatctttttctgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38753181 |
acaacctgtgaattgttgaaccaaagccctgaaatttgtgctattggcattgagaagagtgattggagttttctttgaagctctagatctttttctgatt |
38753082 |
T |
|
| Q |
201 |
ggtttgaatgtgttgttctttggggtcaagtgaccatttgatgacatggtgggacttgttgtcaccatagttgcatgtgagaatccttccatgctaatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38753081 |
ggtttgaatgtgttgttctttggggtcaagtgaccatttgatgacatggtgggacttgttgtaaccatagttgcatgtgagaatccttccatgctaatat |
38752982 |
T |
|
| Q |
301 |
ccatgaaaggttgttgatgatgatgatg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38752981 |
ccatgaaaggttgttgatgatgatgatg |
38752954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 94 - 151
Target Start/End: Original strand, 7006082 - 7006139
Alignment:
| Q |
94 |
tggtaggacaacctgtgaattgttgaaccaaagccctgaaatttgtgctattggcatt |
151 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
7006082 |
tggtaggacagcctgtgaatagttaaaccaaagctctgaaatttgttgtattggcatt |
7006139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University