View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17682_low_16 (Length: 310)
Name: NF17682_low_16
Description: NF17682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17682_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 14 - 299
Target Start/End: Complemental strand, 27870821 - 27870536
Alignment:
| Q |
14 |
catcactaaaaacaggaactggcttcttgctactagcctccattggcctattcaaacattagaaattattttattttcacatagtttcacagacacaagg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27870821 |
catctctaaaaacaggaactggcttcttgctactagcctccattggcctattcaaacattagaaattattttattttcacatagtttcacagacacaagg |
27870722 |
T |
 |
| Q |
114 |
attagaagaaaataaaaaccactttgtcaaacaatcaattgagtgcatgtttggtatcacagtagttttgccaaaatcaaggtgagccaccataattttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27870721 |
attagaagaaaataaaaaccactttgtcaaacaatcaattgagtgcatgtttggtatcacagtagttttgccaaaatcaaggtgagccaccataattttg |
27870622 |
T |
 |
| Q |
214 |
caaacccaccgtgataccaaacatgcactaactattactatgatacaaataaaacacctattcttattgagccttttcaacttctt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27870621 |
caaacccaccgtgataccaaacatgcactaactattactatgatacaaataaaacacctatttttattgagccttttcaacttctt |
27870536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 155 - 217
Target Start/End: Complemental strand, 38729434 - 38729372
Alignment:
| Q |
155 |
agtgcatgtttggtatcacagtagttttgccaaaatcaaggtgagccaccataattttgcaaa |
217 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
38729434 |
agtgcatgtttggtatcatagtcgatttgccgaaatcatggtgagccaccatgattttgcaaa |
38729372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 24030848 - 24030800
Alignment:
| Q |
14 |
catcactaaaaacaggaactggcttcttgctactagcctccattggcct |
62 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24030848 |
catctctaaaagcaggaaccggcttcttgctactagcttccattggcct |
24030800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 242
Target Start/End: Complemental strand, 11134370 - 11134341
Alignment:
| Q |
213 |
gcaaacccaccgtgataccaaacatgcact |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11134370 |
gcaaacccaccgtgataccaaacatgcact |
11134341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University