View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17682_low_23 (Length: 251)
Name: NF17682_low_23
Description: NF17682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17682_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5402027 - 5402085
Alignment:
| Q |
1 |
aattattttgtatttagatgaaaaatatacatgaatgaatatgcaggggatttttttat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402027 |
aattattttgtatttagatgaaaaatatacatgaatgaatatgcaggggatttttttat |
5402085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 5402216 - 5402272
Alignment:
| Q |
185 |
ttcacgttcttcctcgtaaatggtttcaatgataccaatttggttccaacccttcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5402216 |
ttcacgttcttcctcgtaaatggtttcaatgacaccaatttggttccaacccttcat |
5402272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University