View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17682_low_23 (Length: 251)

Name: NF17682_low_23
Description: NF17682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17682_low_23
NF17682_low_23
[»] chr5 (2 HSPs)
chr5 (1-59)||(5402027-5402085)
chr5 (185-241)||(5402216-5402272)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5402027 - 5402085
Alignment:
1 aattattttgtatttagatgaaaaatatacatgaatgaatatgcaggggatttttttat 59  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5402027 aattattttgtatttagatgaaaaatatacatgaatgaatatgcaggggatttttttat 5402085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 5402216 - 5402272
Alignment:
185 ttcacgttcttcctcgtaaatggtttcaatgataccaatttggttccaacccttcat 241  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
5402216 ttcacgttcttcctcgtaaatggtttcaatgacaccaatttggttccaacccttcat 5402272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University