View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17683_high_2 (Length: 505)
Name: NF17683_high_2
Description: NF17683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17683_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 9e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 9e-62
Query Start/End: Original strand, 20 - 164
Target Start/End: Original strand, 4295598 - 4295742
Alignment:
| Q |
20 |
aaaatttgattgggttaagtgggatacaagtatcttgatcagaataatggtggtttaggtgctgatagagtttgaaagtttaatttatatttgttacgta |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4295598 |
aaaatttgattgggttaagtaggatacaagtatcttgatcggaataacggtggtttaggagctgatagagtttgaaagtttaatttatatttgttacgta |
4295697 |
T |
|
| Q |
120 |
aatggcgttgaaggttgcatgtgggtcggtagattatggtttaaa |
164 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4295698 |
aatggtgttgaaggttgcacgtgggtcggtagattatggtttaaa |
4295742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 227 - 257
Target Start/End: Original strand, 41084850 - 41084880
Alignment:
| Q |
227 |
tgtgtggtggaaatatttgcttggtgttaga |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41084850 |
tgtgtggtggaaatatttgcttggtgttaga |
41084880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University